La importancia del genoma del coronavirus SARS-CoV-2 en Costa Rica

Hay muchos beneficios derivados en relación con la importancia de conocer el genoma completo del coronavirus que transita por nuestras calles, el cual está afectando la vida de muchas personas en todo el mundo.

El genoma se refiere a la información genética total de un organismo, pero veamos qué significa esto. Es algo así como si dispusiéramos de una biblioteca compuesta por varios libros, y de repente es necesario leer y comprender el contenido de cada uno de ellos. No obstante, para emprender dicha tarea, en primer momento, debemos saber leer e interpretar el significado de los distintos párrafos contenidos en esos libros. El principio aplica para el coronavirus, si queremos conocer su genoma.

El coronavirus SARS-CoV-2 tiene un “libro” en su interior y está compuesto por 30,000 letras que definen su “material genético”. Esta cadena monocatenaria positiva se llama ARN (ácido ribonucleico o “texto genético” del virus) y está constituida, básicamente, por una combinación de los siguientes caracteres: A, C, G, U. Es decir, es exactamente igual que abrir las páginas de un libro y la combinación de caracteres (sin espacios) que componen el texto fueran: UGAAUGUCUUAAAUUGUCAC, etc. hasta llegar a 30,000 caracteres (genoma ARN). La totalidad de esa información genética o letras, en el caso del virus SARS-CoV-2 que produce la enfermedad de COVID-19, es fundamentalmente lo que buscamos para obtener el genoma del virus o lo que es lo mismo, según la clasificación a partir de la familia a la que pertenece: el genoma del coronavirus.

Para efectuar en Costa Rica la lectura del genoma del coronavirus SARS-CoV-2 circulante (secuenciación genómica), es necesario, primero, realizar la lectura de su texto genético o las 30,000 letras mencionadas anteriormente, que en su defecto son poco más de siete páginas convencionales tamaño carta completamente llenas, a tamaño normal y sin espacio. Para desarrollar directamente esta tarea, se usa un equipo conocido como plataforma de secuenciación de nueva generación (acrónimo en inglés: NGS, o Next Generation Sequencing).

Estos aparatos pueden tomar el material genético del virus (preparado previamente en un laboratorio experimental) y leerlo rápidamente, inclusive hay modelos portátiles del tamaño de un teléfono celular (operan bajo un principio de nanoporos), adecuado también para trabajo en condiciones remotas ó difíciles. Sin embargo, estas tecnologías son limitadas y no pueden hacer toda la lectura de manera consecutiva, solo pueden leer “trozos” del contenido genético total. Por tanto, en general, producen cientos de miles o millones de lecturas como si fueran piezas de un rompecabezas que luego son almacenadas digitalmente. Debido a ello, luego es necesario unir todas esas piezas (imagen del rompecabezas) con distintos procedimientos y métodos de ensamblaje de tipo computacional.

En Costa Rica, disponemos de la tecnología e infraestructura de secuenciación genómica suficiente para emprender este tipo de trabajo completamente. Y no solo eso, sino también disponemos del recurso humano necesario que tiene “habilidades de lectura rápida y compresión” para interpretar y analizar esos textos “armados” y unidos pieza por pieza. Este profesional científico que analiza los datos genómicos se denomina: bioinformático. Él es capaz de ensamblar, procesar, analizar, interpretar y compartir la información que nos revela el virus sobre su propia existencia, relacionada con su constitución, interacción y funcionalidad molecular en general. Hoy en día trabajar en genómica es imposible sin la ayuda de la Bioinformática.

Así mismo, disponemos al momento de una infraestructura nacional de ocho secuenciadores genómicos de nueva generación, distribuidos en las siguientes instituciones, universidades, centros y ministerios: MAG, CIHATA, HNN, HSJD, dos en UCR, OIJ, INCIENSA (Ministerio de Salud). Con estos aparatos podemos leer los genomas de bacterias, virus, plantas, animales y humanos.

El conocimiento genómico nos puede ayudar a diferenciar cepas virales, sus posibles cambios y comprender mejor su funcionamiento en general. Al determinar el genoma del virus, no encontramos nada fundamentalmente distinto a lo conocido hasta ahora y se parece mucho al genoma de los demás virus SARS-CoV-2 transmitidos en el mundo. Pero las pequeñas diferencias que se pueden encontrar en “letras” es clave, porque podemos conocer si el virus ha cambiado, es más o menos agresivo, y así por tanto comprender mejor sus instrucciones moleculares (básicas y complejas) y tomar acciones inmediatas en aspectos de salud pública. En resumen, obtener su “manual de instrucciones” es la base para comprender mejor su comportamiento biológico molecular con su hospedero, evolución y dinámica poblacional.

A través del genoma del coronavirus, podemos conocer su origen, caracterización, mecanismos funcionales y de interacción, variabilidad mutacional (cambios de ciertas letras o partes de su genoma), transferencia comunitaria, control epidemiológico y muchas características más. Por otra parte, también es radicalmente importante, especialmente, para el diseño de vacunas, dianas terapéuticas y su respectiva efectividad en nuestra población. Además, en estudios más complejos podría tal vez explicar el efecto de las diferencias genéticas interindividuales, vulnerabilidad, síntomas, acción de mecanismos inmunitarios, riesgos y diferentes tipos de respuestas de la infección producida por el COVID-19.  Este conocimiento podría ser fundamental para dirigir tratamientos más precisos y efectivos en los pacientes infectados.

Actualmente, en el caso particular del coronavirus SARS-CoV-2 ya el Instituto Costarricense de Investigación y Enseñanza en Nutrición y Salud (INCIENSA) en el marco de trabajo del Consejo de Bioinformática Clínica (creado por decreto nacional N°40800-S-MICITT), ha logrado obtener seis genomas completos, y está coordinando para obtener 144 genomas adicionales (por síntesis y nanoporos). Estos genomas se obtendrían en colaboración con todos los grupos del Consejo Técnico de Bioinformática (CTBC) que incluyen instituciones como UCR, UNA, TEC, UNED, LANOTEC (CENAT), HNN, SENASA, y CRBiomed, en un trabajo colaborativo con el apoyo del Ministerio de Salud. Tanto el INCIENSA como el CTBC, junto con el proyecto de la Red Nacional de Secuenciación Genómica y Supercomputación son parte del Ministerio de Salud.

Hay muchos beneficios derivados en relación con la importancia de conocer el genoma completo del coronavirus que transita por nuestras calles, el cual está afectando la vida de muchas personas en todo el mundo.

SUSCRÍBASE A LA EDICIÓN SEMANAL EN FORMATO DIGITAL.Precio: ₡12.000 / añoPRECIO ESPECIAL

0 comments